Serpina1f^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpina1f^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade A, member 1F; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5649012
• Synonyms: Serpina1f^em1J
• Gene: Serpina1f Location: Chr12:103654303-103661788 bp, - strand Genetic Position: Chr12, 52.98 cM
• Alliance: Serpina1f^em1(IMPC)J page
• IMPC: Serpina1f gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Serpina1f-6844-M9369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CTGGGTAGTTCCTGGGACTG, TGGATCGGGTATGATGAAGT and AGGAGCCCGGAGCCTCCTCT which resulted in a 117 bp deletion beginning in exon 3, CGATCCAGGGAAGATGCAGAAGG, at Chromosome 12 negative strand position 103,691,823 bp and ending after AACTACCCAGAGGCATCC at position 103,691,707 bp (GRCm38) in intron 4. This mutation causes a deletion of exon 3 after 28bp and removes the splice donor from the end of the exon, which may allow for read through in the intron in which case this mutation would be predicted to result in an amino acid change after residue 219 and truncation 39 residues later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Serpina1f Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)