About   Help   FAQ
Serpina1fem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpina1fem1(IMPC)J
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1F; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5649012
Synonyms: Serpina1fem1J
Gene: Serpina1f  Location: Chr12:103654303-103661788 bp, - strand  Genetic Position: Chr12, 52.98 cM
Alliance: Serpina1fem1(IMPC)J page
IMPC: Serpina1f gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Serpina1f-6844-M9369 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CTGGGTAGTTCCTGGGACTG, TGGATCGGGTATGATGAAGT and AGGAGCCCGGAGCCTCCTCT which resulted in a 117 bp deletion beginning in exon 3, CGATCCAGGGAAGATGCAGAAGG, at Chromosome 12 negative strand position 103,691,823 bp and ending after AACTACCCAGAGGCATCC at position 103,691,707 bp (GRCm38) in intron 4. This mutation causes a deletion of exon 3 after 28bp and removes the splice donor from the end of the exon, which may allow for read through in the intron in which case this mutation would be predicted to result in an amino acid change after residue 219 and truncation 39 residues later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Serpina1f Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory