About   Help   FAQ
Wdr17em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr17em1(IMPC)J
Name: WD repeat domain 17; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5649014
Synonyms: Wdr17em1J
Gene: Wdr17  Location: Chr8:55082316-55180014 bp, - strand  Genetic Position: Chr8, 29.28 cM, cytoband B3.1
Alliance: Wdr17em1(IMPC)J page
IMPC: Wdr17 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Wdr17-6900-M282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TTAGTTAATCACACCTTCGA, CGTTCCAAATGATCACTAAG and AACAGTTGAGTTCTTCTTTT, which resulted in a 159 bp deletion beginning in intron 4 at Chromosome 8 negative strand position 54,693,261 bp starting at GTTGGGCATGCTTTGTTTTAG and ending after TAACTTAGTGATCATTTGG at position 54,693,103 bp in exon 4 (GRCm38). This mutation removes 21 bp from intron 4 and 138bp from exon 4 essentially deleting exon 4 from the transcript, and is predicted to cause an amino acid change after residue 65 and early truncation 141 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wdr17 Mutation:  83 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory