Tusc3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tusc3^em1(IMPC)J
• Name: tumor suppressor candidate 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5659636
• Synonyms: Tusc3^em1J
• Gene: Tusc3 Location: Chr8:39472999-39619367 bp, + strand Genetic Position: Chr8, 23.89 cM, cytoband B1.2
• Alliance: Tusc3^em1(IMPC)J page
• IMPC: Tusc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tusc3-6898J-M247 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATGGGAGTGAATCCAAGGG, ACGATCATGGAGTAGTTCCG and ATCTCGCTCTAAGTCTAAGT, which resulted in a 106 bp deletion beginning in exon 2 at Chromosome 8 positive strand position 39,046,620 bp, at CGGAACTACTCCATGATCGTCATG, and ending after CCTTGAGAAAAGCAGCAGCCTA at position 39,046,725 bp in intron 3 (GRCm38). This mutation deletes 64 bp in exon 2 and 42 bp into intron 3 removing the splice donor site. This mutation is predicted to cause an early truncation after amino acid residue 81 and early truncation after amino acid residue 83. In addition there is a 23 bp deletion in intron 2 (AAGGGAGGAACACCCTGTAACTT) Chromosome 8 positive strand position 39,046,469 - 39,046,492 bp, which is not predicted to affect the amino acid sequence. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tusc3 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)