Mrpl44^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrpl44^em1(IMPC)J
• Name: mitochondrial ribosomal protein L44; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662419
• Synonyms: Mrpl44^-, Mrpl44^em1J
• Gene: Mrpl44 Location: Chr1:79753735-79759162 bp, + strand Genetic Position: Chr1, 40.96 cM
• Alliance: Mrpl44^em1(IMPC)J page
• IMPC: Mrpl44 gene page

Mrpl44^em1(IMPC)J/Mrpl44^em1(IMPC)J mice exhibit embryonic lethality with embryos recovered at E7.5 but not at E9.5. Embryos are small and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mrpl44-6962J-M4324 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TCTAACAGTCTAAATACAAA, AAGTTAGAGCACACCTTACG, GTTGTACCAAGATCTAGCAA, and ACAGTCTTCATGTGGGCAGA, which resulted in a 604bp deletion beginning in intron 2 at Chromosome 1 positive strand position 79,777,806 bp, CTTACGTGGTACCATGCCCT, and ending after TTTCTCATGCATTCCTTTGC at 79,778,409 bp (GRCm38/mm10) in intron 3. This mutation results in the deletion of exon 2 and is predicted to cause amino acid sequence changes after 60 residues and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	12 assay results
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrpl44 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)