Mrpl3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrpl3^em1(IMPC)J
• Name: mitochondrial ribosomal protein L3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662430
• Synonyms: Mrpl3^-, Mrpl3^em1J
• Gene: Mrpl3 Location: Chr9:104930394-104954665 bp, + strand Genetic Position: Chr9, Syntenic
• Alliance: Mrpl3^em1(IMPC)J page
• IMPC: Mrpl3 gene page

Mrpl3^em1(IMPC)J/Mrpl3^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but a primitive streak and hallmarks of gastrulation are not seen at 7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mrpl3-6966J-F0101 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: CACTTCTTATAATAACACGG, ACAAACCACACCATTCCCTG, CAAGCCATACTGTAATTAAG, TTATCTGGAAACAAATAAGC, which resulted in a 355 bp deletion beginning in intron 2 at Chromosome 9 positive strand position 105,054,289 bp, CCCCGTGTTATTATAAGAAGTGT, and ending after GATGTGACCCCTTAATTAC at position 105,054,643 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 45 amino acids later. There is an additional 37 bp deletion in intron 3, downstream of the 355 bp deletion, that is not expected to impact the exon deletion results. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	14 assay results
In Structures Affected by this Mutation:	6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrpl3 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)