About   Help   FAQ
Pla2g7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pla2g7em1(IMPC)J
Name: phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662431
Synonyms: Pla2g7em1J
Gene: Pla2g7  Location: Chr17:43879009-43923093 bp, + strand  Genetic Position: Chr17, 19.74 cM, cytoband C
Alliance: Pla2g7em1(IMPC)J page
IMPC: Pla2g7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pla2g7-7002J-F3490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TAGCCAGTCCGCCTAAAAGT, AGTAGGTGCTAGGAATTCCA, GTCATTCTCAGGAGACTGCA, and GCTGTTGCAACAGGGATGGC, which resulted in a 301 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 43,594,225 bp, CTACTTTTAGGCGGACTGGCTA, and ending after CTAACCGGCCATCCCTGTTG at 43,594,525 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 35 and early truncation 30 amino acids later. There is an additional 16 bp deletion 12 bases before the beginning of the 301 bp deletion. This additional deletion is in intron 3 and is not expected to impact the exon deletion results. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pla2g7 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory