Krt80^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt80^em1(IMPC)J
• Name: keratin 80; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662436
• Synonyms: Krt80^em1J
• Gene: Krt80 Location: Chr15:101246196-101268043 bp, - strand Genetic Position: Chr15, 56.78 cM, cytoband F3
• Alliance: Krt80^em1(IMPC)J page
• IMPC: Krt80 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Krt80-6977J-M3128 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: ACTTCCTCTTTCTCCACCTT,CACCCCACCAGAGTACAGCC, TGACAGGGAGCCCCACCTCG, and AGATGAGCTGCCCTGTGACA, which resulted in a 378 bp deletion beginning in intron 2 at Chromosome 15 negative strand position 101,364,511 bp, GTGACAGGGAGCCCCACCTCG, and ending after CTGGTGGGGTGCACCCAAG at 101,364,134 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause an early stop after amino acid residue 101. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Krt80 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)