Mon1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mon1a^em1(IMPC)J
• Name: MON1 homolog A, secretory traffciking associated; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5662453
• Synonyms: Mon1a^em1J
• Gene: Mon1a Location: Chr9:107765350-107780338 bp, + strand Genetic Position: Chr9, 59.07 cM, cytoband F2
• Alliance: Mon1a^em1(IMPC)J page
• IMPC: Mon1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mon1a-6967J-F4413 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GAGGTAAAAGAAGGACACCA, CTAAGTCAACGACCTGGGGA, CTAGTGACTGAGCAACATGT, GTAGAATAGCCAGGCCTCCA, which resulted in a 355bp deletion beginning in intron 2 at Chromosome 9 positive strand position 107,898,539 bp, GAAGCCATCCCCAGGTCGTTGACTTA, and ending after CTTCCTTTCCTTCCTACATG at 107,898,893 bp (GRCm38/mm10) in intron 3, which results in the deletion of exon 2, which is the first coding exon, so lacks the translation start site and first 42 amino acids and is predicted to be a null allele. If splicing and translation occurs from the first ATG in exon 3, this would produce a 507 amino acid protein that differs from wildtype by the lack of the first 49 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mon1a Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)