About   Help   FAQ
Egfem1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Egfem1em1(IMPC)J
Name: EGF-like and EMI domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5662543
Synonyms: Egfem1em1J
Gene: Egfem1  Location: Chr3:29136172-29745358 bp, + strand  Genetic Position: Chr3, 12.57 cM, cytoband A3
Alliance: Egfem1em1(IMPC)J page
IMPC: Egfem1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Egfem1-6963J-F4337 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: GCAGGGTTTGAATTAGAGGG, TGGGAGGTAGACGAATAAGA, GACAAGTTATATGTTACAAG, CTTGTAACATATAACTTGTC, which resulted in a 273bp deletion beginning in intron 3 at Chromosome 3 positive strand position 29,151,713 bp, ATTCGTCTACCTCCCAATGTATGT, and ending after CTTCCTGACAAGTTATATGTTAC at 29,151,985 bp (GRCm38/mm10) in intron 4. This mutation results in the deletion of exon3 and is predicted to cause a change in amino acid sequence after residue 74 and early truncation 35 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Egfem1 Mutation:  50 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory