About   Help   FAQ
Zfp422em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp422em1(IMPC)J
Name: zinc finger protein 422; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688574
Synonyms: Zfp422em1J
Gene: Zfp422  Location: Chr6:116600977-116605960 bp, - strand  Genetic Position: Chr6, 53.83 cM
Alliance: Zfp422em1(IMPC)J page
IMPC: Zfp422 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp422-7040J-M1223 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CCACACTCATCACAGCAGTA and GTGGCCATTCGCTTCGACTC, which resulted in a 301 bp deletion beginning in exon 2 at Chromosome 6 negative strand position 116,626,917bp, CTCGGGCTTGAGTCGACGGA, and ending after ACCGGCGAGAAGCCCTACTGC at 116,626,617 bp (GRCm38/mm10) in exon 2. This mutation results in the deletion of 301 bp in exon 2 and results in an amino acid sequence change after residue 40 and early truncation 41 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp422 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory