About   Help   FAQ
Arr3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arr3em1(IMPC)J
Name: arrestin 3, retinal; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688598
Synonyms: Arr3em1J
Gene: Arr3  Location: ChrX:99649103-99662099 bp, + strand  Genetic Position: ChrX, 43.72 cM, cytoband C2
Alliance: Arr3em1(IMPC)J page
IMPC: Arr3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arr3-7032J-M2356 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATCCTCATTGCCCTTCCATT, CCATTCTTCAGCATCTCGGT, ATTGGCCTCATAGCTCTGCA, and AGGCCAATTGAAAGGTAGAA, which resulted in a 313 bp deletion beginning in intron 4 at Chromosome X positive strand position 100,606,939 bp at GAATGGAAGGGCAATGAGGATG and ending after GAAAGGAAAGAATCCTTTCAG at 100,607,251 bp (GRCm38/mm10) in intron 5. This mutation results in the deletion of exon4 and is predicted to cause a change in amino acid sequence after residue 13 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arr3 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory