Adgra1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Adgra1em1(IMPC)J |
Name: |
adhesion G protein-coupled receptor A1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5688779 |
Synonyms: |
Adgra1em1J |
Gene: |
Adgra1 Location: Chr7:139414090-139458004 bp, + strand Genetic Position: Chr7, 84.89 cM
|
Alliance: |
Adgra1em1(IMPC)J page
|
IMPC: |
Adgra1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Adgra1-6965J-M4387 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTGACTGATACGGATGGCCA, ACAAGTCACATAAAGAGCCC, GTCCCAGGATGGAAGGATTG, and GGCTCAAGTCCCAGGATGGA, which resulted in a 254 bp deletion beginning in intron 4 at Chromosome 7 positive strand position 139,845,536 bp, GAGCCCTGGCCATCCGTATCAGT, and ending after CCCAATCCTTCCATCCTGG at 139,845,789 bp(GRCm38/mm10) in intron 5. The 254 bp mutation deletes all of exon 4 and is predicted to result in a change of amino acid sequence after amino acid 4 and early truncation 61 amino acids later.
(J:188991)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|