About   Help   FAQ
Adgra1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adgra1em1(IMPC)J
Name: adhesion G protein-coupled receptor A1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688779
Synonyms: Adgra1em1J
Gene: Adgra1  Location: Chr7:139414090-139458004 bp, + strand  Genetic Position: Chr7, 84.89 cM
Alliance: Adgra1em1(IMPC)J page
IMPC: Adgra1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Adgra1-6965J-M4387 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTGACTGATACGGATGGCCA, ACAAGTCACATAAAGAGCCC, GTCCCAGGATGGAAGGATTG, and GGCTCAAGTCCCAGGATGGA, which resulted in a 254 bp deletion beginning in intron 4 at Chromosome 7 positive strand position 139,845,536 bp, GAGCCCTGGCCATCCGTATCAGT, and ending after CCCAATCCTTCCATCCTGG at 139,845,789 bp(GRCm38/mm10) in intron 5. The 254 bp mutation deletes all of exon 4 and is predicted to result in a change of amino acid sequence after amino acid 4 and early truncation 61 amino acids later. (J:188991)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adgra1 Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory