About   Help   FAQ
Sprr1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sprr1aem1(IMPC)J
Name: small proline-rich protein 1A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688853
Synonyms: Sprr1aem1J, Sprr1ahypo
Gene: Sprr1a  Location: Chr3:92391261-92393188 bp, - strand  Genetic Position: Chr3, 40.14 cM
Alliance: Sprr1aem1(IMPC)J page
IMPC: Sprr1a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Hypomorph)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sprr1a-7038J-M1170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TCGGGAACAACAGGGTGGCA, and GGGTTGCAGGGCTCAGGAAC, which resulted in a 237 bp deletion beginning in exon 2 at Chromosome 3 negative strand position 92,484,565 bp, CTGTTCCTGAGCCCTGCAAC, and ending after GGCGCCTGAGCCCTGCCACC at 92,484,329 bp (GRCm38/mm10) in exon 2. This mutation results in the deletion in exon 2 of 237 bp and results in an amino acid change after 44 residues and early truncation 21 amino acids later. (J:188991, J:338379)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sprr1a Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory