About   Help   FAQ
E130311K13Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: E130311K13Rikem1(IMPC)J
Name: RIKEN cDNA E130311K13 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689821
Synonyms: E130311K13Rikem1J
Gene: E130311K13Rik  Location: Chr3:63822105-63836893 bp, - strand  Genetic Position: Chr3, 30.08 cM
Alliance: E130311K13Rikem1(IMPC)J page
IMPC: E130311K13Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project E130311K13RIK-7012J-M2RMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AACAACTGTAGTGATTGTTA, AGAAAGAAAGTTAAACTACG, and TGTCTTCTTGTTAAATGCTT, which resulted in a 139 bp deletion beginning in intron 3 at Chromosome 3 negative strand position 63,925,555 bp, TAAATGCTTAGGTATCTTCACAT, and ending after AAGAAAGAAAGTTAAACTACG at 63,925,417bp(GRCm38/mm10) in exon 3. This mutation deletes the splice acceptor as well as 64bp from exon 3 essentially removing the entire exon. This mutation is predicted to result in amino acid sequence change after 58 residues and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any E130311K13Rik Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory