About   Help   FAQ
Nadk2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Nadk2em1(IMPC)J
Name: NAD kinase 2, mitochondrial; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689888
Synonyms: Nadk2em1J
Gene: Nadk2  Location: Chr15:9071340-9110584 bp, + strand  Genetic Position: Chr15, 3.82 cM, cytoband A2
Alliance: Nadk2em1(IMPC)J page
IMPC: Nadk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TTACGGTAAGTCCAAGCGAT and TTGAAAGGCTCGAGCTACAG, which resulted in a 94 bp deletion beginning in exon 2 at Chromosome 15 position 9,083,375 bp, CCATCGCTTGGACTTACCGTA, and ending after GTAGTCCACTGTAGCTCGAGCC at 9,083,282 bp (GRCm38/mm10) in intron 2. This 94 bp deletion begins after the initial 12 bp of coding sequence of exon 2 and includes 77 bp of exon 2 then 17 bp of intron 2 including the splice donor sequence, and is predicted to cause a read-through into intron 2, which results in amino acid sequence changes after amino acid 92 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nadk2 Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory