Slc6a20b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc6a20b^em1(IMPC)J
• Name: solute carrier family 6 (neurotransmitter transporter), member 20B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5689889
• Synonyms: Slc6a20b^em1J
• Gene: Slc6a20b Location: Chr9:123422888-123461603 bp, - strand Genetic Position: Chr9, 74.19 cM, cytoband F4
• Alliance: Slc6a20b^em1(IMPC)J page
• IMPC: Slc6a20b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Slc6a20b-6846J-M9395 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGAGGATACAGGCCTCTAGG, ACTTCAATGTCATCAACACC and TCTGTCCTAGGGATCTTTAC, which resulted in a 183 bp deletion beginning at Chromosome 9 negative strand position 123,610,427 bp, TTACAGGTTGGGCTATTCACA, and ending after GGGAGAGGATACAGGCCTC, at 123,610,245 bp (GRCm38/mm10) in intron 4. This 183 bp mutation completely deletes exon 3 and flanking intronic sequences. It is predicted to result in a change in amino acid sequence after amino acid 131 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc6a20b Mutation: 35 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)