About   Help   FAQ
Zfp174em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp174em1(IMPC)J
Name: zinc finger protein 174; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689892
Synonyms: Zfp174em1J
Gene: Zfp174  Location: Chr16:3665132-3676744 bp, + strand  Genetic Position: Chr16, 2.26 cM
Alliance: Zfp174em1(IMPC)J page
IMPC: Zfp174 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp174-7014J-2R1L(MP1) was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATAGAGTGACCCCCTTACCC, TCCCAGCAGAGACATTCAGG, TGGGAGGCTGTGATGGAAAG, which resulted in a 194 bp deletion beginning in intron 2 at Chromosome 16 positive strand position 3,849,266 bp, TAAGGGGGTCACTCTATAGC, and ending after CTCCCAGCAGAGACATTC at 3,849,459 bp(GRCm38/mm10) in exon 2. This mutation deletes 85 bp of intronic sequence and the splice acceptor as well as 109 bp of exon 2 resulting in a complete deletion of exon 2. This mutation is predicted to result in a change of amino acid sequence after amino acid 134 and early truncation 4 amino acids later. There is also an additional 15 bp insertion, GAATGGAGATAAGAG, at position 3,849,603 bp in intron 3 that will not affect the predicted mutation. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp174 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory