About   Help   FAQ
Zfp641em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp641em1(IMPC)J
Name: zinc finger protein 641; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689903
Synonyms: Zfp641em1J
Gene: Zfp641  Location: Chr15:98183466-98194042 bp, - strand  Genetic Position: Chr15, 54.29 cM
Alliance: Zfp641em1(IMPC)J page
IMPC: Zfp641 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp641-7067J-M4958 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ACGGGAACTAACAAGCCAGT, GCAGCCGCACTTCTTGCAGC, and AAGTGCATCCTGGGAAAGAT, which resulted in a 214 bp deletion beginning in intron 3 at Chromosome 15 negative strand position 98,293,024 bp, GAAAGATGGGTAGTTCATC, and ending after CTTTGGCATCATCCCACTGG at 98,292,811 bp(GRCm38/mm10) in intron 4. The 214 bp mutation deletes all of exon 3 and is predicted to result in a change of amino acid sequence after amino acid 61 and early truncation 64 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfp641 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory