Zfp579^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp579^em1(IMPC)J
• Name: zinc finger protein 579; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5696236
• Synonyms: Zfp579^em1J
• Gene: Zfp579 Location: Chr7:4995851-4999100 bp, - strand Genetic Position: Chr7, 2.88 cM, cytoband A1
• Alliance: Zfp579^em1(IMPC)J page
• IMPC: Zfp579 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Zfp579-7041J-M1234 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CGGAAAGCTTTGGGGCACAG and CCAAGAGCACGCAGGTAGCG, which resulted in a 1 bp T insertion in exon 1 beginning at Chromosome 7 positive strand position 49,94,713bp (GRCm38/mm10). This mutation results in a change of amino acid sequence after amino acid residue 78 and early truncation 49 amino acid residues later. In addition, 141 bases after the T insertion there is an 8 bp deletion GTAGCGAG, which does not appear to affect the result of the insertion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp579 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)