Cldn13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cldn13^em1(IMPC)J
• Name: claudin 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5697043
• Synonyms: Cldn13^em1J
• Gene: Cldn13 Location: Chr5:134943103-134944380 bp, - strand Genetic Position: Chr5, 74.88 cM
• Alliance: Cldn13^em1(IMPC)J page
• IMPC: Cldn13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: This allele from project Cldn13-6968J-M3024 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CATGGTCGTCAGCAAACAAG, along with a non-contributing plasmid, which resulted in a 1 bp insertion (G) in exon 1 beginning at Chromosome 5 negative strand position 134,915,313 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 31 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cldn13 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)