Gpr15^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr15^em1(IMPC)J
• Name: G protein-coupled receptor 15; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5697047
• Synonyms: Gpr15^em1J
• Gene: Gpr15 Location: Chr16:58537796-58539433 bp, - strand Genetic Position: Chr16, 34.83 cM
• Alliance: Gpr15^em1(IMPC)J page
• IMPC: Gpr15 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gpr15-6923J-M9817 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATACAACTGTGTAAAAGATA, with a non-contributing plasmid, which resulted in an 8 bp deletion (CTCCCTAT) in exon 1 beginning at Chromosome 16 negative strand position 58,718,619bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 36 and early truncation 39 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gpr15 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)