About   Help   FAQ
Kcnb2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnb2em1(IMPC)J
Name: potassium voltage gated channel, Shab-related subfamily, member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5697048
Synonyms: Kcnb2em1J
Gene: Kcnb2  Location: Chr1:15357478-15793974 bp, + strand  Genetic Position: Chr1, 4.5 cM
Alliance: Kcnb2em1(IMPC)J page
IMPC: Kcnb2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kcnb2-6924J-M9857 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGCTTCCCCAGGCGTGTCCG, with a non-contributing plasmid, which resulted in an 8 bp deletion (CCGGACAC) in exon1 beginning at Chromosome 1 positive strand position 15,312,622 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 57 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnb2 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory