Kcnb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnb2^em1(IMPC)J
• Name: potassium voltage gated channel, Shab-related subfamily, member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5697048
• Synonyms: Kcnb2^em1J
• Gene: Kcnb2 Location: Chr1:15357478-15793974 bp, + strand Genetic Position: Chr1, 4.5 cM
• Alliance: Kcnb2^em1(IMPC)J page
• IMPC: Kcnb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Kcnb2-6924J-M9857 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGCTTCCCCAGGCGTGTCCG, with a non-contributing plasmid, which resulted in an 8 bp deletion (CCGGACAC) in exon1 beginning at Chromosome 1 positive strand position 15,312,622 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 57 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnb2 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)