Kcnc3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnc3^em1(IMPC)J
• Name: potassium voltage gated channel, Shaw-related subfamily, member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5697086
• Synonyms: Kcnc3^em1J
• Gene: Kcnc3 Location: Chr7:44240088-44254178 bp, + strand Genetic Position: Chr7, 28.85 cM
• Alliance: Kcnc3^em1(IMPC)J page
• IMPC: Kcnc3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Kcnc3-7063J-F4895 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCTTCTAAAGAACTTGGTGG, CTACTATGCCGAACGCATCG, and AGAGGTGATTGAAACCAACA, which resulted in a 1182 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 44,595,080 bp, GTGAGGCCACCACCAAGTTCTTTAG, and ending after CAAGAAGAGGTGATTGAAACCAACA at 44,596,261 bp (GRCm38/mm10). This mutation deletes most of exon 2, except for the last 7 bp, and deletes the splice acceptor. It is predicted to result in a change in amino acid sequence after 291 amino acid residues and early truncation 71 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnc3 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)