About   Help   FAQ
Arhgap29em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arhgap29em1(IMPC)J
Name: Rho GTPase activating protein 29; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749747
Synonyms: Arhgap29em1J
Gene: Arhgap29  Location: Chr3:121746752-121810326 bp, + strand  Genetic Position: Chr3, 52.94 cM
Alliance: Arhgap29em1(IMPC)J page
IMPC: Arhgap29 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arhgap29-7394J-F2209 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTGCTTCAAAGCACAAAG, AGATCAGTTGCAGTAAGTGG, TGTACGGTACATGAATCTGC, and ACATGAATCTGCGGGATAAA, which resulted in a 274 bp deletion spanning exon 4 beginning at Chromosome 3 positive strand position 121,988,385 bp, TTTGTGCTTTGAAGCAATGGTG, and ending after TACGGTACATGAATCTGCGG at 121,988,658 bp (GRCm38/mm10). There is a 36 bp insertion in the intron that will not affect the exon deletion. This mutation deletes exon 4 and 177 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 114 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arhgap29 Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory