Arhgap29^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap29^em1(IMPC)J
• Name: Rho GTPase activating protein 29; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5749747
• Synonyms: Arhgap29^em1J
• Gene: Arhgap29 Location: Chr3:121746752-121810326 bp, + strand Genetic Position: Chr3, 52.94 cM
• Alliance: Arhgap29^em1(IMPC)J page
• IMPC: Arhgap29 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arhgap29-7394J-F2209 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTGCTTCAAAGCACAAAG, AGATCAGTTGCAGTAAGTGG, TGTACGGTACATGAATCTGC, and ACATGAATCTGCGGGATAAA, which resulted in a 274 bp deletion spanning exon 4 beginning at Chromosome 3 positive strand position 121,988,385 bp, TTTGTGCTTTGAAGCAATGGTG, and ending after TACGGTACATGAATCTGCGG at 121,988,658 bp (GRCm38/mm10). There is a 36 bp insertion in the intron that will not affect the exon deletion. This mutation deletes exon 4 and 177 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 114 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arhgap29 Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)