Cdin1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdin1^em1(IMPC)J
• Name: CDAN1 interacting nuclease 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5749789
• Synonyms: BC052040^em1J, Cdin1^-
• Gene: Cdin1 Location: Chr2:115412197-115609249 bp, + strand Genetic Position: Chr2, 58.18 cM
• Alliance: Cdin1^em1(IMPC)J page
• IMPC: Cdin1 gene page

Cdin1^em1(IMPC)J/Cdin1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form typical outgrowth colonies.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project BC052040-7395J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAACATGTGCACACAG, GGTCATGCAGTGACAAGGAA, CTACTCTAGATAGGCCCCTT, and TAAACCTGAGCTAAACCTAA, which resulted in a 195 bp deletion spanning exon 4 beginning at Chromosome 2 positive strand position 115,638,917 bp, GGAGAAACATGTGCACACAGG, and ending after AACCTGAGCTAAACCTAAGG at 115,639,111 bp (GRCm38/mm10). This mutation deletes exon 4 and 134 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 71 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdin1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)