Dgkh^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dgkh^em1(IMPC)J
• Name: diacylglycerol kinase, eta; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5749809
• Synonyms: Dgkh^em1J
• Gene: Dgkh Location: Chr14:78796789-78970169 bp, - strand Genetic Position: Chr14, 41.56 cM
• Alliance: Dgkh^em1(IMPC)J page
• IMPC: Dgkh gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Dgkh-7399J-M2307 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAAGATGCAAGTTTTGGCC, GTACATAGATACCTTATCTC, GCTTCGGTGTTCACAGTAAC, and CGAAGACAACGTTCAGTCAG, which resulted in a 295 bp deletion spanning exon 5 beginning at Chromosome 14 positive strand position 78,627,550 bp, GCCAAAACTTGCATCTTAATT, and ending after AAGACAACGTTCAGTCAGAG at 78,627,844 bp (GRCm38/mm10). There is also a 6bp (ctgtta) insertion in the intron that will not affect the exon deletion. This mutation deletes exon 5 and 164 bp of intronic sequence including the splice acceptor and donor. This mutation causes amino acid sequence change after residue 160 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dgkh Mutation: 57 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)