Tbc1d5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d5^em1(IMPC)J
• Name: TBC1 domain family, member 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5750182
• Synonyms: Tbc1d5^em1J
• Gene: Tbc1d5 Location: Chr17:51040152-51486380 bp, - strand Genetic Position: Chr17, 26.47 cM
• Alliance: Tbc1d5^em1(IMPC)J page
• IMPC: Tbc1d5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tbc1d5-7380J-M1353 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTCAGTGATCCCTGTGT, TAGGAAAGGAACCAGATCAG, AGCACTCCTCTTGTAGTAGA, and CCTGGAAGATTACCCACACA, which resulted in a 231 bp deletion spanning exon 5 beginning at Chromosome 17 negative strand position 50,968,324 bp, CCCCTGATCTGGTTCCTTTCC, and ending after CCACACAGGGATCACTGAAA at 50,968,094 bp (GRCm38/mm10). This mutation deletes exon 5 and 112 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after 55 residues and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tbc1d5 Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)