Nectin4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nectin4^em1(IMPC)J
• Name: nectin cell adhesion molecule 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5752746
• Synonyms: Nectin4^em1J
• Gene: Nectin4 Location: Chr1:171197741-171215855 bp, + strand Genetic Position: Chr1, 79.37 cM, cytoband H2
• Alliance: Nectin4^em1(IMPC)J page
• IMPC: Nectin4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pvrl4-7418J-M4968 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGACTCTGAGCTTGGGCT, GGACTCTGAGCTTGGGCTGG, TCTATGCCCCGACTTAGCTA and TCTGAACCCTAGCTAAGTCG, which resulted in a 401 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 171,383,458 bp GGTCTTATGAGCTCAGGGCA and ending after ACATATTCTGAACCCTAGCT at 171,383,858 bp (GRCm38/mm10). This mutation deletes exon 4 and 280 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after amino acid residue 242 and early truncation 11 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nectin4 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)