Scamp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scamp2^em1(IMPC)J
• Name: secretory carrier membrane protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5752771
• Synonyms: Scamp2^em1J
• Gene: Scamp2 Location: Chr9:57468226-57496078 bp, + strand Genetic Position: Chr9, 31.05 cM
• Alliance: Scamp2^em1(IMPC)J page
• IMPC: Scamp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Scamp2-7483J-M6175 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAGCATTAAGGAATACCAT, CCAGCACAGGCACTTCACCC, ACTCTGAACCACCTTCATGG, and CCTGCTCTACCTGGCACAAG, which resulted in a 349 bp deletion spanning ENSMUSE00000259135 (exon 4) beginning at Chromosome 9 positive strand position 57,579,268 bp, GGCACTCCCATGGTATTCCTT and ending after TACTCTGAACCACCTTCATG at 57,579,616 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause a change in amino acid sequence after residue 75 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Scamp2 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)