Ofcc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ofcc1^em1(IMPC)J
• Name: orofacial cleft 1 candidate 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5752778
• Synonyms: Ofcc1^em1J
• Gene: Ofcc1 Location: Chr13:40155358-40514926 bp, - strand Genetic Position: Chr13, 19.45 cM
• Alliance: Ofcc1^em1(IMPC)J page
• IMPC: Ofcc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ofcc1- 7447J-M8483 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGCCTGACCAAATCCATG, GCAACGCCAGTGAACATGTA, TCTTTCTTATATGGAATAAG, and AGTCAATGTTAAAACAATGA, which resulted in a 435 bp deletion spanning exon 5 beginning at Chromosome 13 negative strand position 40,255,271 bp, TTATTCCATATAAGAAAGAAA and ending after TCCTATCTTTCCACATGGAT at 40,255,271 bp (GRCm38/mm10). This mutation deletes exon 5 and 268 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 114 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ofcc1 Mutation: 74 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)