Mpz^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mpz^em1(IMPC)Tcp
• Name: myelin protein zero; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754548
• Gene: Mpz Location: Chr1:170978282-170988699 bp, + strand Genetic Position: Chr1, 79.05 cM
• Alliance: Mpz^em1(IMPC)Tcp page
• IMPC: Mpz gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0238 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and one guide RNA with the spacer sequence TCTTGCCCACTATGTCCGGT and an oligonucleotide repair template. Non-homologous end-joining repair resulted in a 19 bp deletion from Chr1:171158916 to 171158934 in ENSMUSE00000476648. This mutation is predicted to cause a frameshift with amino acid changes after residue 134 and early truncation 20 amino acids later (p.D134Lfs*22). The repair template was not integrated. (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mpz Mutation: 28 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)