Hgsnat^em4(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hgsnat^em4(IMPC)Tcp
• Name: heparan-alpha-glucosaminide N-acetyltransferase; endonuclease-mediated mutation 4, The Centre for Phenogenomics
• MGI ID: MGI:5754568
• Gene: Hgsnat Location: Chr8:26434481-26466781 bp, - strand Genetic Position: Chr8, 14.22 cM
• Alliance: Hgsnat^em4(IMPC)Tcp page
• IMPC: Hgsnat gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0253, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GCAGGTTAACTCCACCTCGG and ACAGAGACAGGTGCCACGCT. This resulted in a 38 bp deletion from Chr8:25971576 to 25971613 (GRCm38) in exon 3 (ENSMUSE00000347052). This mutation is predicted to cause a frameshift with amino acid changes after residue 133 and early truncation 24 amino acids later (p.I133Lfs*25). (J:165963)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Hgsnat Mutation: 40 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)