About   Help   FAQ
Cstdc2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cstdc2em1(IMPC)Tcp
Name: cystatin domain containing 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754573
Gene: Cstdc2  Location: Chr2:148686540-148692882 bp, - strand  Genetic Position: Chr2, 73.58 cM
Alliance: Cstdc2em1(IMPC)Tcp page
IMPC: Cstdc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0381 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TTGCAGTTCAGGTAAGGGGC and TTCACGAAGAAAGTTTGTGG. This resulted in a 77-bp del on Chr2 from 148847934 to 148848010 with a 1-bp insertion of G (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cstdc2 Mutation:  14 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory