Gpr141b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr141b^em1(IMPC)Tcp
• Name: G protein-coupled receptor 141B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754575
• Gene: Gpr141b Location: Chr13:19911596-19917121 bp, - strand Genetic Position: Chr13, 7.03 cM
• Alliance: Gpr141b^em1(IMPC)Tcp page
• IMPC: Gpr141b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with the spacer sequences CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC. This resulted in a 737-bp deletion in Chr13:19729115 to 19729852 (ENSMUSE00000732266; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 10 and early truncation 41 amino acids later (p.S10Ffs*43). (J:165963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpr141b Mutation: 20 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)