Minar1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Minar1^em1(IMPC)Tcp
• Name: membrane integral NOTCH2 associated receptor 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754580
• Gene: Minar1 Location: Chr9:89469269-89505178 bp, - strand Genetic Position: Chr9, 47.24 cM
• Alliance: Minar1^em1(IMPC)Tcp page
• IMPC: Minar1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0387, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences GGGCACAGAGTGACTTGCAC, ACTGTATCCCCCAGTTTGGT and ACTTCGGGTCAGGCCAAGTA. This resulted in a 1,410 bp deletion from 89601843 to 89603253 on Chr 9 encompassing exon ENMUSE00000334339. This mutation is predicted to cause a frameshift with amino acid changes after residue 31 and early truncation 2 amino acids later (p.C31Tfs*4). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Minar1 Mutation: 36 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)