Atl3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atl3^em1(IMPC)Tcp
• Name: atlastin GTPase 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754584
• Gene: Atl3 Location: Chr19:7471178-7515974 bp, + strand Genetic Position: Chr19, 5.32 cM
• Alliance: Atl3^em1(IMPC)Tcp page
• IMPC: Atl3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0366 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TGGAAAACCTGGTCCAGTGC and GATCTCGGATATGGTCTTGG in ENSMUSE00000144777. This resulted in a 83-bp deletion from Chr19:7509375 to 7509457 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atl3 Mutation: 56 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)