Baz2a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Baz2a^em1(IMPC)Tcp
• Name: bromodomain adjacent to zinc finger domain, 2A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754585
• Gene: Baz2a Location: Chr10:127927453-127965172 bp, + strand Genetic Position: Chr10, 76.4 cM, cytoband D3
• Alliance: Baz2a^em1(IMPC)Tcp page
• IMPC: Baz2a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0415 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and single guide RNAs with spacer sequences of AGCACACAAGCTTGATAAAC and GTGTAGGACTGTCTGCATGC targeting the 5' side and GTTCTACTCATGCCTTCCAA and ATAGTAATGGCCAAACGAGA targeting the 3' side of exons 9-11 (ENSMUSE00000272786, ENSMUSE00000272778, and ENSMUSE00000471272) resulting in a 1,067-bp deletion in Chr10:128115947 to 128117012, and insAAGCA (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Baz2a Mutation: 132 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)