Ccnb1ip1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccnb1ip1^em1(IMPC)Tcp
• Name: cyclin B1 interacting protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754587
• Gene: Ccnb1ip1 Location: Chr14:51026706-51033185 bp, - strand Genetic Position: Chr14, 26.25 cM
• Alliance: Ccnb1ip1^em1(IMPC)Tcp page
• IMPC: Ccnb1ip1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0410 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAATACCTTGGTCTTTCCA and TTTGCAATTATCGGAAGTGT targeting the 5' side and ATCCCGCAGTCTGGAGTCTT and ACCACAGTAAACTGAGCTGT targeting the 3' side of exons ENSMUSE00000617176 and ENSMUSE00000617175. This resulted in a 2,142-bp deletion from Chr14:50791871 to 50794011 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccnb1ip1 Mutation: 22 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)