Fam170a^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam170a^em1(IMPC)Tcp
• Name: family with sequence similarity 170, member A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754599
• Gene: Fam170a Location: Chr18:50411436-50416087 bp, + strand Genetic Position: Chr18, 27.3 cM
• Alliance: Fam170a^em1(IMPC)Tcp page
• IMPC: Fam170a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0407, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GAGTGTGGAGTGCGATAGTG, TGTCACACTAATGTCACTCG, GAGGTGCAAGCCTACCCTAG and TCCGAACTTCCTGCGGGAGC. This resulted in a 1,167 bp deletion from Chr18:50281278 to 50282444, encompassing ENSMUSE00000373759. (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam170a Mutation: 26 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)