About   Help   FAQ
G6pd2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: G6pd2em1(IMPC)Tcp
Name: glucose-6-phosphate dehydrogenase 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754601
Gene: G6pd2  Location: Chr5:61966186-61967820 bp, + strand  Genetic Position: Chr5, 31.99 cM
Alliance: G6pd2em1(IMPC)Tcp page
IMPC: G6pd2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0362 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CGGAACAGCCACCAGATGGT and CTGCAATTCCGAGATATACC. This resulted in an 894 bp deletion from Chr5:61809118 to 61810011, and ins 152bp in exon ENSMUSE00000409179. This mutation is predicted to cause a frameshift with amino acid changes after residue 80 and early truncation 12 amino acids later (p.I80Cfs*14). (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any G6pd2 Mutation:  27 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory