G6pd2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: G6pd2^em1(IMPC)Tcp
• Name: glucose-6-phosphate dehydrogenase 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754601
• Gene: G6pd2 Location: Chr5:61966186-61967820 bp, + strand Genetic Position: Chr5, 31.99 cM
• Alliance: G6pd2^em1(IMPC)Tcp page
• IMPC: G6pd2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0362 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CGGAACAGCCACCAGATGGT and CTGCAATTCCGAGATATACC. This resulted in an 894 bp deletion from Chr5:61809118 to 61810011, and ins 152bp in exon ENSMUSE00000409179. This mutation is predicted to cause a frameshift with amino acid changes after residue 80 and early truncation 12 amino acids later (p.I80Cfs*14). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any G6pd2 Mutation: 27 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 5 reference(s)