Gm4922^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm4922^em1(IMPC)Tcp
• Name: predicted gene 4922; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754602
• Gene: Gm4922 Location: Chr10:18655475-18662541 bp, - strand Genetic Position: Chr10, 7.92 cM
• Alliance: Gm4922^em1(IMPC)Tcp page
• IMPC: Gm4922 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0417 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences GTGAGCTCGGTCTTGGTTTG, CTTCAGGACGGTGTACTGCC, CAGCTCAGTGTCCTAATCAC, and ATGTCCGTTTGGCAGAATAG. This resulted in a 5-bp deletion from Chr10:18785183 to 18785187, a 1,713-bp deletion from Chr10:18783181 to 18784893 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) & 6-bp deletion from Chr10:18783159 to 18783164 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gm4922 Mutation: 29 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)