L3mbtl3^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: L3mbtl3^em2(IMPC)Tcp
• Name: L3MBTL3 histone methyl-lysine binding protein; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5754603
• Gene: L3mbtl3 Location: Chr10:26150366-26251967 bp, - strand Genetic Position: Chr10, 13.67 cM
• Alliance: L3mbtl3^em2(IMPC)Tcp page
• IMPC: L3mbtl3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0370 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCCAAGATTGACGTGTAGAT and GAAGGCACTACATCTAATGC. This resulted in a 734 bp deletion from Chr10:26342355 to 26343088 in ENSMUSE00000309524 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any L3mbtl3 Mutation: 52 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)