Mvk^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mvk^em1(IMPC)Tcp
• Name: mevalonate kinase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754606
• Gene: Mvk Location: Chr5:114582330-114598652 bp, + strand Genetic Position: Chr5, 55.99 cM
• Alliance: Mvk^em1(IMPC)Tcp page
• IMPC: Mvk gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0322 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATAGGTGACTTAGCCTGACG and AGCCTCACCAACACGGGCAA. This resulted in a 672-bp deletion from Chr5:114452046 to 114452717 (GRCm38), OTTMUSE00000170059. (J:165963)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mvk Mutation: 19 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 5 reference(s)