Ndufs2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ndufs2^em1(IMPC)Tcp
• Name: NADH:ubiquinone oxidoreductase core subunit S2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754607
• Gene: Ndufs2 Location: Chr1:171062426-171078956 bp, - strand Genetic Position: Chr1, 79.25 cM
• Alliance: Ndufs2^em1(IMPC)Tcp page
• IMPC: Ndufs2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0320 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 mRNA and two single guide RNAs with spacer sequences AACCGACTATCTAAAATGAT targeting the 5' side and GTATACATCAAGGCGTGTGT targeting the 3' side of exon 4 (exon OTTMUSE00000270987). This resulted in a 547 bp deletion from Chr1:171239045 to 171239591, OTTMUSE0000027098 (GRCm38). (J:165963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ndufs2 Mutation: 33 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)