About   Help   FAQ
Ndufs2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ndufs2em1(IMPC)Tcp
Name: NADH:ubiquinone oxidoreductase core subunit S2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754607
Gene: Ndufs2  Location: Chr1:171062426-171078956 bp, - strand  Genetic Position: Chr1, 79.25 cM
Alliance: Ndufs2em1(IMPC)Tcp page
IMPC: Ndufs2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0320 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 mRNA and two single guide RNAs with spacer sequences AACCGACTATCTAAAATGAT targeting the 5' side and GTATACATCAAGGCGTGTGT targeting the 3' side of exon 4 (exon OTTMUSE00000270987). This resulted in a 547 bp deletion from Chr1:171239045 to 171239591, OTTMUSE0000027098 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ndufs2 Mutation:  33 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory