Pgbd1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pgbd1^em1(IMPC)Tcp
• Name: piggyBac transposable element derived 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755026
• Gene: Pgbd1 Location: Chr13:21605445-21625228 bp, - strand Genetic Position: Chr13, 7.79 cM
• Alliance: Pgbd1^em1(IMPC)Tcp page
• IMPC: Pgbd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele produced from project TCPR0368 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GGAACAGGACATGCACCTAG and AGGGAGTGACCGAAGACTGC. This resulted in a 61 bp deletion from Chr13:21433448 to 21433508 in ENSMUSE00000571630. This mutation is predicted to cause a frameshift with amino acid changes after residue 57 and early truncation 51 amino acids later (p.L57Rfs*53) (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pgbd1 Mutation: 27 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)