Polr3a^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr3a^em2(IMPC)Tcp
• Name: polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5755039
• Gene: Polr3a Location: Chr14:24498764-24537126 bp, - strand Genetic Position: Chr14, 14.4 cM
• Alliance: Polr3a^em2(IMPC)Tcp page
• IMPC: Polr3a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA, the guide sequence CCGGCATTTATCTGAGATCTTCT, and a donor oligo, which resulted in a 1 bp insertion at Chr14:24482833_insT in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Polr3a Mutation: 70 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)