Pstpip2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pstpip2^em1(IMPC)Tcp
• Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755044
• Gene: Pstpip2 Location: Chr18:77882250-77971462 bp, + strand Genetic Position: Chr18, 52.38 cM, cytoband E3
• Alliance: Pstpip2^em1(IMPC)Tcp page
• IMPC: Pstpip2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0319, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences TCCACATTTTGCTCGGCTCA, CTGCGTTTTACCTTCCCCAA, GTACAGATTCATGGGCCCAC, and GCAGGCGGGTGTGAAGCATC. This resulted in a 686 bp deletion from Chr18:77847879 to 77848564 encompassing ENSMUSE00000514786. (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pstpip2 Mutation: 25 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)