Ptp4a1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptp4a1^em2(IMPC)Tcp
• Name: protein tyrosine phosphatase 4a1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5755068
• Gene: Ptp4a1 Location: Chr1:30979384-30988838 bp, - strand Genetic Position: Chr1, 11.47 cM
• Alliance: Ptp4a1^em2(IMPC)Tcp page
• IMPC: Ptp4a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences ATGCTACGTGTTATGTTGGG and AGTCCTGTCCTGCATGCAGG. This resulted in a 915 bp deletion from Chr1:30944289 to 30945203 encompassing OTTMUSE00000245667 & OTTMUSE00000245014 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ptp4a1 Mutation: 15 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)