About   Help   FAQ
Ptp4a1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ptp4a1em2(IMPC)Tcp
Name: protein tyrosine phosphatase 4a1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:5755068
Gene: Ptp4a1  Location: Chr1:30979384-30988838 bp, - strand  Genetic Position: Chr1, 11.47 cM
Alliance: Ptp4a1em2(IMPC)Tcp page
IMPC: Ptp4a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences ATGCTACGTGTTATGTTGGG and AGTCCTGTCCTGCATGCAGG. This resulted in a 915 bp deletion from Chr1:30944289 to 30945203 encompassing OTTMUSE00000245667 & OTTMUSE00000245014 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 9 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ptp4a1 Mutation:  15 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/09/2024
MGI 6.24
The Jackson Laboratory