Radil^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Radil^em1(IMPC)Tcp
• Name: Ras association and DIL domains; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755070
• Gene: Radil Location: Chr5:142470594-142536853 bp, - strand Genetic Position: Chr5, 81.53 cM
• Alliance: Radil^em1(IMPC)Tcp page
• IMPC: Radil gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0369 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences gagtttactctgacatacct and CCCGTTGGCAGTGGTCTAGC. This resulted in a 2486 bp deletion from Chr5:142506252 to 142508737 encompassing ENSMUSE00001259653 & ENSMUSE00001280414 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Radil Mutation: 119 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)