Raly^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Raly^em2(IMPC)Tcp
• Name: hnRNP-associated with lethal yellow; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5755074
• Gene: Raly Location: Chr2:154633016-154709181 bp, + strand Genetic Position: Chr2, 76.83 cM
• Alliance: Raly^em2(IMPC)Tcp page
• IMPC: Raly gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0318, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATCTATACTCAAATATAGTC, ATGTAAATGACTTTATTACC, CCTCCTAGTTCTTGTAGAGT, and GCAGTCAAAGTGTGAGACTT. This resulted in a 850-bp deletion from Chr2:154859330 to 154860179 (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Raly Mutation: 56 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)